No waste of time on internet! located genuine source of ASC-012 questions.

ASC-012 boot camp | ASC-012 exam tips | ASC-012 practice exam | ASC-012 exam results | ASC-012 past exams - bigdiscountsales.com



ASC-012 - ASC High Availablity Assessment - Dump Information

Vendor : Symantec
Exam Code : ASC-012
Exam Name : ASC High Availablity Assessment
Questions and Answers : 75 Q & A
Updated On : December 13, 2017
PDF Download Mirror : ASC-012 Brain Dump
Get Full Version : Pass4sure ASC-012 Full Version

Ensure your success with this ASC-012 question bank


The best way to get accomplishment in the Symantec ASC-012 exam is that you ought to acquire dependable preliminary materials. We guarantee that killexams.com is the most direct pathway towards certifying Symantec ASC High Availablity Assessment exam. You will be triumphant with full certainty. You can see free questions at killexams.com before you purchase the ASC-012 exam items. Our mimicked tests are in different decision the same as the real exam design. The questions and answers made by the confirmed experts. They give you the experience of taking the real test. 100% assurance to pass the ASC-012 real test.

killexams.com Symantec Certification contemplate guides are setup by IT experts. Bunches of understudies have been whining that there are excessively numerous questions in such huge numbers of training exams and study aides, and they are quite recently tired to manage the cost of any more. Seeing killexams.com specialists work out this extensive form while still certification that all the information is secured after profound research and examination. Everything is to make comfort for competitors on their street to accreditation.

We have Tested and Approved ASC-012 Exams. killexams.com gives the most exact and most recent IT exam materials which practically contain all information focuses. With the guide of our ASC-012 exam materials, you don't have to squander your opportunity on perusing main part of reference books and simply need to burn through 10-20 hours to ace our ASC-012 real questions and answers. Also, we furnish you with PDF Version and Software Version exam questions and answers. For Software Version materials, It's offered to give the hopefuls reproduce the Symantec ASC-012 exam in a real environment.

We give free refresh. Inside legitimacy period, if ASC-012 exam materials that you have bought updated, we will intimate you by email to download most recent version of Q&A. In the event that you don't pass your Symantec ASC High Availablity Assessment exam, We will give you full refund. You have to send the checked duplicate of your ASC-012 examination report card to us. Subsequent to affirming, we will rapidly give you FULL REFUND.

In the event that you get ready for the Symantec ASC-012 exam utilizing our testing software. It is anything but difficult to prevail for all confirmations in the main endeavor. You don't need to manage all dumps or any free downpour/rapidshare all stuff. We offer free demo of every IT Certification Dumps. You can look at the interface, question quality and convenience of our training exams before you choose to purchase.

Killexams.com Huge Discount Coupons and Promo Codes are as under;
WC2017 : 60% Discount Coupon for all exams on website
PROF17 : 10% Discount Coupon for Orders greater than $69
DEAL17 : 15% Discount Coupon for Orders greater than $99
DECSPECIAL : 10% Special Discount Coupon for All Orders



ASC-012 Discount Coupon, ASC-012 Promo Code, ASC-012 vce, Free ASC-012 vce, Download Free ASC-012 dumps, Free ASC-012 braindumps, pass4sure ASC-012, ASC-012 practice test, ASC-012 practice exam, killexams.com ASC-012, ASC-012 real questions, ASC-012 actual test, ASC-012 PDF download, Pass4sure ASC-012 Download, ASC-012 help, ASC-012 examcollection, Passleader ASC-012, exam-labs ASC-012, Justcertify ASC-012, certqueen ASC-012, ASC-012 testking

View Full Exam »



No cheaper source of ASC-012 Q&A found but.

I am glad to inform that I have successfully passed the ASC-012 Exam. In this context I must admit that your Question Bank did help (if not fully) to tied over the exam as the questions asked in the exam were not fully covered by your question bank. HOwever I must congratulate your effort to make us technically sound with your Q&As. Thanks to killexams.com for clearing my ASC-012 exam in first class.

top notch source of high-quality actual Questions, correct solutions.

I didnt plan to use any brain dumps for my IT certification checks, however being below pressure of the issue of ASC-012 exam, I ordered this package deal. i was inspired by the pleasant of these substances, they're genuinely worth the money, and that i believe that they might value more, that is how great they may be! I didnt have any hassle while taking my exam thanks to Killexams. I definitely knew all questions and solutions! I got 97% with only a few weeks exam education, except having a few work revel in, which turned into actually useful, too. So sure, Killexams is clearly top and distinctly endorsed.

No worries when preparing for the ASC-012 exam.

by no means suspected that the issues that I had dependably fled from would be any such splendid amount of enjoyableto examine; its easy and brief approach for buying to the focuses made my planning component less worrying and helpme in getting 89% marks. All because of killexams.com dumps, I never concept i would bypass my exam yet I did enddecisively. i was going to give up exam ASC-012 when you consider that I wasnt nice approximately whether i would pass or not. With truely every week staying I selected to switch to Dumps for my examination making plans.

How to prepare for ASC-012 exam in shortest time?

The study material of ASC-012 exam is outlined properly for get ready inside a short period of time. Killexams Questions & Answers made me score 88% in the wake of answering all questions 90 minutes of time. The exam paper ASC-012 has various study materials in business sector. Yet it got to be exceptionally troublesome for me to pick the best one. Be that as it may after my brother requested that I used killexams.com Questions & Answers, I didnt look at for other books. Much obliged for supporting me.

Prepare ASC-012 Questions and Answers otherwise Be prepared to fail.

I didnt plan to use any brain dumps for my IT certification checks, however being below pressure of the issue of ASC-012 exam, I ordered this package deal. i was inspired by the pleasant of these substances, they're genuinely worth the money, and that i believe that they might value more, that is how great they may be! I didnt have any hassle while taking my exam thanks to Killexams. I definitely knew all questions and solutions! I got 97% with only a few weeks exam education, except having a few work revel in, which turned into actually useful, too. So sure, Killexams is clearly top and distinctly endorsed.

Found an accurate source for real ASC-012 Actual Questions.

The killexams.com killexams.com are the top notch product as it's miles each easy to apply and easy to put together thrutheir high-quality Dumps. in many methods it motivated me, it's far the tool which I used each day for my learning. The manual is suited for the preparing. It helped me to perform a great score within the very last ASC-012 exam. It offers the expertise to carry out better inside the exam. thanks very for the extraordinary assist.

precisely equal questions, WTF!

Passing the ASC-012 exam turned into just impossible for me as I couldnt control my training time nicely. Left with handiest 10 days to head, I referred the examination by using killexams.com and it made my life clean. subjects have been provided nicely and was dealt well within the take a look at. I scored a terrifi 959. thanks killexams. i was hopeless however killexams.com given me hope and helped for passing whilst i used to be hopeless that i cant end up an IT licensed; my friend instructed me approximately you; I attempted your on-line education equipment for my ASC-012 examination and became capable of get a 91 bring about examination. I very own thanks to killexams.

ASC-012 exam prep got to be this easy.

The killexams.com dumps offer the observe cloth with the proper capabilities. Their Dumps are making gaining knowledge of smooth and short to prepare. The furnished material is highly custom designed with out turning intooverwhelming or burdensome. The ILT ebook is used along with their cloth and observed its effectiveness. I recommendthis to my friends at the workplace and to each person attempting to find the fine solution for the ASC-012 examination. thanks.

ASC-012 exam is not any extra hard to pass with these Q&A.

thank you plenty killexams.com crew, for getting ready surprising exercise assessments for the ASC-012 exam. it's miles evident that without killexams.com exam engine, college students cannot even think of taking the ASC-012 examination. I tried many different sources for my examination preparation, but I couldn't find myself assured sufficient for taking the ASC-012 exam. killexams.com exam guide makes clean examination preparation, and gives self assurance to the scholars for taking examination without difficulty.

actual ASC-012 exam questions to pass at first strive.

i am operating into an IT company and therefore I hardly ever discover any time to put together for ASC-012 examination. therefore, I arise to an easy end of killexams.com Q&A dumps. To my surprise it worked like wonders for me. I ought to solve all the questions in least possible time than furnished. The questions seem to be pretty clean with exquisite reference manual. I secured 939 marks which was honestly a first-rate wonder for me. remarkable thanks to killexams!

See more Symantec dumps

ST0-250 | 251-351 | 250-253 | 250-410 | ST0-172 | ST0-100 | 250-510 | ST0-12W | ST0-91W | 250-407 | 250-512 | 251-365 | 250-318 | 250-370 | 250-250 | ST0-075 | 250-365 | ST0-141 | 250-371 | ST0-130 | ST0-91X | 250-316 | 250-505 | ST0-025 | 250-622 | 250-501 | ST0-174 | 250-270 | 250-315 | 250-502 | ST0-173 | ST0-096 | ST0-148 | ST0-303 | ST0-202 | 250-240 | ST0-151 | ST0-10X | 251-312 | ST0-030 | 250-401 | 250-400 | 250-403 | 250-314 | ST0-237 | ST0-47X | 250-101 | ST0-200 | 250-530 | 850-001 |

Latest Exams added on bigdiscountsales

1Z0-453 | 210-250 | 300-210 | 500-205 | 500-210 | 70-765 | 9A0-409 | C2010-555 | C2090-136 | C9010-260 | C9010-262 | C9020-560 | C9020-568 | C9050-042 | C9050-548 | C9050-549 | C9510-819 | C9520-911 | C9520-923 | C9520-928 | C9520-929 | C9550-512 | CPIM-BSP | C_TADM70_73 | C_TB1200_92 | C_TBW60_74 | C_TPLM22_64 | C_TPLM50_95 | DNDNS-200 | DSDPS-200 | E20-562 | E20-624 | E_HANABW151 | E_HANAINS151 | JN0-1330 | JN0-346 | JN0-661 | MA0-104 | MB2-711 | NSE6 | OMG-OCRES-A300 | P5050-031 |

See more dumps on bigdiscountsales

050-686 | 000-082 | 000-M73 | E20-520 | 117-102 | 650-127 | ISSEP | A2090-730 | HP2-K24 | 600-199 | 350-026 | 1Z0-550 | P2070-053 | | E20-322 | ST0-174 | HP0-J67 | 00M-227 | 920-163 | P2050-028 | 700-801 | BCP-521 | 650-665 | 0B0-106 | C_HANAIMP_11 | EADA10 | M2150-756 | E20-005 | A2010-657 | 640-461 | 3309 | 10-184 | 300-070 | 000-281 | ST0-147 | M70-301 | 650-328 | 000-M93 | 300-101 | 000-529 | 000-111 | 210-020 | S10-100 | HP2-037 | F50-526 | EE0-021 | JN0-694 | 1Z0-436 | HP2-061 | FINRA |

ASC-012 Questions and Answers

ASC-012


VCS is running on all three nodes, and the configuration is closed. The administrator runs "hastop -all -force", manually edits the main.cf on NodeA, and runs hastart on NodeA, but VCS does not start. Which command should they run to identify the problem?


  1. hastart -force

  2. hasys -force NodeA

  3. hacf -verify

  4. haconf -verify


Answer: C


QUESTION: 71

Which tool is required to collect information about a cluster to send to Symantec Support?


  1. SORT scripts

  2. VRTSexplorer

  3. VEA GUI and VCS GUI

  4. Vertias cluster server simulator


Answer: B


QUESTION: 72

In a two-node VCS cluster, all heartbeat links simultaneously failed when a quad-ethernet card that supports these networks went down on one of the servers. What might this cause?


  1. The GAB membership will go into a jeopardy state to prevent any service groups from failing over.

  2. The violation trigger script will be called to shutdown one of the servers to minimize the risk of data corruption.

  3. Thecluster will partition and create a split-brain condition which may result in data corruption.

  4. The service groups will be auto-disabled until one or more of the heartbeat links resumes.


Answer: C


For what two purposes should the VCS Simulator tool be used? (Select two.)


  1. To replay and simulate the event captured in the VCS log files for investigating problems

  2. To enable offline testing of VCS configurations

  3. To pre-stage VCS configurations before they are rolled-out to the cluster nodes

  4. To simulate servers and arrays used in a VCS configuration

  5. To simulate VCS configurations for testing custom agents and scripts


Answer: B, C


QUESTION: 74

Which of the following enables you to test the O/S and application configuration of a node by bringing up the application on an inactive node without stopping the application on the primary node ordisrupting user access?


  1. HA Fire Drill

  2. VVR

  3. VCS Simulator

  4. Fire Drill using snapshots


Answer: D


QUESTION: 75

A customer wants to deploy two production applications, each with its own corresponding test application and wants to prevent production applications running on the same system as test applications. What should be the best practice recommendation?


  1. Deploy all four applications in one single cluster and use offline local dependencies

  2. Deploy two clusters with each containing a production application and its corresponding test application and use offline local dependencies

  3. Deploy two clusters with each containing a production application and its corresponding test application and use system limits and service group prerequisites

  4. Deploy two clusters, one containing both production applications and one containing both test applications


Answer: D


Symantec ASC-012 Exam (ASC High Availablity Assessment) Detailed Information

Train. Certify. Succeed!
Validate technical knowledge and competency by becoming a Symantec Certified Specialist (SCS) based on your specific area of Symantec technology expertise. To achieve this level of certification, candidates must pass one proctored SCS exam based on a combination of Symantec training material, commonly referenced product documentation, and real-world job scenarios.
Certification News
Find out what’s new in the Symantec Certification Program.
Prepare for an Exam
View the list of available exams and see the exam details and recommended preparation for each exam.
Learn about new item types on SCS exams.
Certification Process
Learn about the Certification Testing Process to find out how to register for exams and view exam fees.
Or, register for an exam now.
Certification Documents and Policies
Certification Documents and Policies
Learn about the Symantec Testing Policies and exam security protocols prior to taking your exam.
Manage Your Credentials
Manage Your Credentials
Log in to CertTracker to view exam progress and publish your credentials.
Subject Matter Expert Central
Register for notifications and/or to participate in our certification exam development process. Help design, write, or beta test the next generation of Symantec Certification Exams.
FAQ
Read some frequently asked questions about Symantec Education Services and find out how to get additional help.
Why Get Certified?
Did you know that Symantec certifications ranked #1 as the top product vendor cyber security certifications by salary in the IT Security Salary Survey (Certification Magazine, November 2015) and that 76% of candidates and recruiters verified that Symantec Certification was discussed as part of the hiring process? Certification can open the door to increased visibility, better opportunities and new jobs in your industry. In today’s highly competitive environment, certification differentiates you as a professional who is serious about applied learning, making you an asset to a prospective employer. Read about the benefits of certification.
Symantec Training
We provide a number of training options to suit your schedule, budget and experience. Online eLearning courses are provided to you at no cost while Virtual Academy and classroom training are provided to you at a reduced cost.
Benefits
Gain a competitive edge
Close more business
Drive larger deals with improved knowledge
Smoother solution deployments
Differentiate yourself from the competition
Satisfy customer needs by selling the right solution
Achieve program membership status with access to more Partner Program benefits
Online eLearning
No cost eLearning that is available online exclusively to Symantec Partner Program members. Earning Symantec accreditations and authorizations may give you access to revenue enhancing and profitability programs. eLearning courses are organized into learning paths that prepare you to successfully complete the Symantec credentials:
Symantec Sales Expert (SSE)
Symantec Sales Expert Plus (SSE+)
Symantec Certified Specialist (SCS)
Virtual Academy
Online learning that recreates the traditional classroom experience via live webcasts, hands-on labs, on-demand modules and expert mentoring. Benefits include:
Less time out of the field
No travel costs
Attend any class in the world
Classroom training
Fee-based technical courses at Symantec locations around the world, offering the same content and in
FAQ
What is the Symantec Certification Program?
The Symantec Certification Program provides rigorous, objective assessments of Symantec technical expertise through securely proctored, computer-based, multiple-choice exams (based on real-world job tasks). The program validates the skills and technical competencies necessary for Symantec professionals to efficiently implement, administer, and maintain their data protection, high availability, and security environments utilizing Symantec solutions.
Successful completion of the programs’ current requirements will result in the achievement and reward of either a Symantec Certified Specialist (SCS) or Symantec Certified Professional (SCP) certificate.
Who is the audience?
Symantec End Users, Customers, Employees, and Partners (optional). Although each product varies in complexity and depth, all certification exams are created specifically for customers and cover core elements measuring technical knowledge against factors such as installation, configuration, deployment, product management & administration, and day-to-day maintenance. While certification is optional for partners and employees, certification is not a requirement of the Symantec Partner Program and does not count toward program classification.
What is a Symantec Certified Specialist?
An End User, Customer, Employee, and/or Partner who has proven technical knowledge and competency by becoming Symantec certified based on their specific area of expertise with Symantec products.
What is a Symantec Certified Professional?
An End User, Customer, Employee, and/or Partner who has proven technical knowledge and competency by becoming Symantec certified based on their specific solution expertise with multiple Symantec products.
Is the Symantec Certification Program available worldwide?
Yes, it is a global certification program for IT professionals working with Symantec solutions worldwide.
What certifications are currently available?
Symantec offers Symantec Certified Specialist (SCS) and Symantec Certified Professional (SCP) certifications covering several different products and solutions by product versions. See more information on the currently available certifications.
Where can I find the individual certification requirements for each certification?
Certification requirements, sample exams, exam objectives, recommended training and registration is available for each certification and corresponding exam. Please click here for more information on Available Certifications.
What is the benefit of becoming Symantec Certified?
Symantec certified candidates and their companies have the ability to gain industry recognition, competitive differentiation, greater productivity & results, increased user community satisfaction, and a tangible measure of their education investment.
Did you know that 76% of candidates and recruiters verified that Symantec Certification was discussed as part of the hiring process? Certification can open the door to increased visibility, better opportunities and new jobs in your industry. In today’s highly competitive environment, certification differentiates you as a professional who is serious about applied learning, making you an asset to a prospective employer. Read about the benefits of Certification for an Individual and Employer.
Does Symantec End User Certification count toward Partner Program requirements and benefits?
End user certification does NOT count toward Partner Program requirements. To learn more view this FAQ sheet (PDF).
Is my Clearwell certification still valid?
See below for details to learn about the acquisition of Clearwell:
Customers
Partners
Is my PGP certification still valid?
See below for details to learn about the legacy acquisition of PGP:
Customers
Partners
Exams
How and where are the exams administered?
Are exams published on the same schedule worldwide?
How do I register and pay for a Symantec certification exam?
How much does it cost to take an exam?
What is the format of the exams?
How much time is allowed to take an exam?
How will I be notified that I have passed an exam?
How will Symantec be notified that I have passed an exam?
What score must I achieve to pass an exam?
Who sees my exam score(s)?
If I do not pass an exam, can I find out which questions I got wrong?
How many times can I take an exam, is there a waiting period, and is there a cost to retake an exam?
How can I find out what topics an exam will cover?
Are the exams based on current Symantec product versions?
How do I know what software release version an exam covers?
Are practice or sample exams available?
Why does Symantec list a range of questions for exams?
How are the exams developed?
How are passing scores established?
Certification
Training and Education
The exams are computer-based and delivered at Pearson VUE testing centers. Pearson VUE provides computer-based testing for information technology, academic, government and professional testing programs around the world. Pearson VUE provides a full suite of services from test development to data management, and delivers exams through the world’s most comprehensive and secure network of Test Center Locations in 175 countries. Pearson VUE is a business of Pearson (NYSE: PSO; LSE: PSON), the international media company, whose businesses include the Financial Times Group, Pearson Education and the Penguin Group.
Are exams published on the same schedule worldwide?
Exams will be available on the same schedule worldwide in English at Pearson VUE. Translations will be determined on a country-by-country basis.
How do I register and pay for a Symantec certification exam?
To register for a Symantec certification exam, login or create a Symantec CertTracker account. Exam fees are payable by credit card or by voucher. View the step-by-step instructions on how to register.
View the step-by-step instructions on how to purchase exam vouchers.
How much does it cost to take an exam?
The fee for a standard released Certification exam is $225 USD (or your country’s currency equivalent).
Symantec reserves the right to change exam fees at any time. Always check Pearson’s website to verify exams costs, schedules, and locations.
What is the format of the exams?
Exams are delivered in multiple-choice format, with each having approximately 65-100 questions. It’s common for the exams to contain exhibits/graphics. Exhibits/graphics are shown directly above the question.
How much time is allowed to take an exam?
Allotted exam time varies by exam length. It typically takes one minute to complete each exam question.
How will I be notified that I have passed an exam?
Pearson VUE provides you with instant results at the completion of your exam. A score report will be printed and given to you before you leave the testing center. Candidates are also able to view exam progress by logging into CertTracker.
How will Symantec be notified that I have passed an exam?
Symantec receives candidate exam results daily via file transfers from Pearson VUE to CertTracker Be sure you keep your personal information in your CertTracker profile up-to-date so that you receive proper credit for exams passed and certifications earned.
What score must I achieve to pass an exam?
Passing scores vary by exam. For more information on specific certifications in each category, please see the certification exam details within your selected product solution training path.
Who sees my exam score(s)?
You, Symantec, and your company (if you designate).
If I do not pass an exam, can I find out which questions I got wrong?
No. Symantec maintains this policy to ensure security over the exam questions.
How many times can I take an exam, is there a waiting period, and is there a cost to retake an exam?
If you do not pass an exam on your first attempt, you must wait at least 3 days (72 hours) before a second attempt. If you do not pass an exam on your second attempt, then you must wait at least 2 weeks (14 days) between each additional attempt. If you need to retake an exam that you have already passed in order to fulfill a certification track requirement, you may do so after 3 months. The same cost applies whether you take an exam once or many times.
How can I find out what topics an exam will cover?
Certification requirements, sample exams, exam objectives, recommended training and registration is available for each certification and corresponding exam. For more information on specific certifications in each category, please see the certification exam details within your selected product solution training path.
Are the exams based on current Symantec product versions?
Exams are developed for the current version of the Symantec product release at the time of development. Exams may be updated after significant new versions are released. New exams may not always correspond to the software release schedule.
How do I know what software release version an exam covers?
For more information on specific certifications in each category, please see the certification exam details within your selected product solution training path.
Are practice or sample exams available?
Sample exams are available. Each sample exam consists of multiple-choice items. Some items may have a supporting exhibit which you will be directed to view before answering the item. The sample exams are not timed, however, you should attempt to complete them as quickly as you can. Certification requirements, sample exams, exam objectives, study guides, recommended training, and registration is available for each certification and corresponding exam. For more information on specific certifications in each category, please see the certification exam details within your selected product solution training path.
Why does Symantec list a range of questions for exams?
Symantec regularly conducts statistical analyses of certification exam results for exam maintenance purposes. In doing so, Symantec publishes a range of questions per exam to account for “unscored” questions. In order to ensure the value of the Symantec certification program, Symantec routinely updates exams with new questions on an unannounced basis. Those new questions are initially delivered as “unscored” so that Symantec can evaluate the performance in the field/on the released exam. The “unscored” questions do not count towards your passing score and additional time is already incorporated into the total exam duration to answer these questions.
Symantec also regularly updates exam questions where the actual number of questions per exam may vary from time to time as these unannounced updates occur.
How are the exams developed?
Symantec end users, both internally and in the field, are studied to define the job performance requirements. The results determine the minimum level of competence required for the defined job performance and is tested in the exams. Symantec follows industry standards for “high stakes” exam development.
How are passing scores established?
Although it is intuitive to think that an appropriate passing score for an examination should be 70 or 75 percent correct based on personal experiences taking classroom tests, these arbitrary values may not reflect the performance level expected of the “minimally qualified candidate” given the difficulty of the test. For example, if the examination is very easy, a passing score of 70 may be too low. However, if the examination is very difficult, this same value may be too high.
Establishing passing scores requires the application of systematic procedures that consider the defined performance level definition of the “minimally qualified candidate” and the difficulty of the examination. Before the final passing scores are established, they are evaluated to ensure that the available validity evidence supports their use for the intended purpose of distinguishing the “minimally qualified candidates” from those who are not yet qualified. This systematic method is used to establish and maintain the fairness, validity and reliability of exams.
In order to ensure the value of the Symantec certification program, Symantec routinely updates exams with new questions. In these cases the passing percentage could change per exam from time to time as these unannounced updates occur

Symantec ASC-012

ASC-012 exam :: Article by ArticleForgeAsc 012 examination questions pass in first effort issuu business brand
  • discover
  • Arts & leisure
  • style & style
  • domestic & backyard
  • enterprise
  • trip
  • schooling
  • sports
  • fitness & fitness
  • routine
  • food & Drink
  • technology
  • Science
  • motors
  • Society
  • religion & Spirituality
  • Pets
  • family unit & Parenting
  • Feminism
  • Go discover
  • writer Plans
  • Cancel sign up check in check in

  • ASICs mediate the modulatory effect by using paeoniflorin on alpha-synuclein autophagic degradation

    four.6. Immunofluorescence microscopy

    For immunofluorescence microscopy, cells seeded on coverslips

    have been cultured in 24-smartly dishes. After remedy with acidic

    medium at pH 6.0 for twenty-four h, cells have been fastened in four% paraformalde-

    hyde (Sigma) for 15 min, washed with PBS, after which permeabi-

    lized with 0.1% Triton-X-a hundred(Sigma) for 15 min. The basic anti-

    ASICs (ASIC1, ASIC2, ASIC3, ASIC4) antibody (1:250 dilution, Santa

    Cruz; Alomone Labs) became added into the cells and incubated at

    room temperature for two h and Cy3-conjugated anti-goat anti-

    bodies (1:500; Beyotime Institute of Biotechnology) have been used

    for 1 h. eventually, after the cells had been incubated with 4′,6-diamidino-

    2-phenylindo le: DAPI (3 μg/ml, Sigma) for 10 min, the slides were

    established with Citiflour (C itiflour Ltd.). The cells were then

    visualized beneath a Leica TSC ST2 confocal microscope.

    four.7. facts

    All facts are expressed as t-check. Two-neighborhood comparisons had been

    performed the use of student's t-test. numerous-neighborhood comparisons

    have been carried out the use of one-method evaluation of variance and

    Fisher's least large difference (equal variances assumed) or

    Dunnett's T3-check (equal variances now not assumed). A probability

    lower than 0.05 changed into regarded statistically big.

    Acknowledgments

    we're grateful to Dr. Jin Tao of Soochow institution for his

    tips, generosity and fabulous aid with facilities

    and reagents. We also thank professor Tian-le Xu in Labora-

    tory of Synaptic Physiology, Institute of Neuroscience of

    chinese Academy of Sciences. We additionally thank Xing-shun Xu

    for essential analyzing of the paper. This work is supported through

    promises from the Jiangsu Province basis of China.

    REFERENCES

    Arias, R.L., Sung, M.L., Vasylyev, D., Zhang, M.Y., Albinson, ok., Kubek,

    okay.,Kagan, N., Beyer,C., Lin, Q., Dwyer,J.M., Zaleska, M.M.,Bowlby,

    M.R., Dunlop, J., Monaghan, M., 2008. Amiloride is

    neuroprotective in an MPTP model of Parkinson's ailment.

    Neurobiol. Dis. 31, 334–341

    .

    Cai, Z.L., Shi, J.J., Yang, Y.P., Cao, B.Y., Wang, F., Huang, J.Z., Yang,

    F., Zhang, P., Liu, C.F., 2009. MPP

    +

    impairs autophagic clearance

    of alpha-synuclein via impairing the recreation of dynein.

    Neuroreport 20, 569–573

    .

    Cao, B.Y., Yang, Y.P., Luo, W.F., Mao, C.J., Han, R., solar, X., Cheng, J.,

    Liu, C.F., 2010. Paeoniflorin, a effective herbal compound,

    protects PC12 cells from MPP

    +

    and acidic harm by way of

    autophagic pathway. J. Ethnopharmacol. 131, 122–129

    .

    Cherra III, S.J., Kulich, S.M., Uechi, G., Balasubramani, M.,

    Mountzouris, J., Day, B.W., Chu, C.T., 2010. rules of the

    autophagy protein LC3 by phosphorylation. J. mobile Biol. 190,

    533–539

    .

    Chu, X.P., Miesch, J., Johnson, M., Root, L., Zhu, X.M., Chen, D.,

    Simon, R.P., Xiong, Z.G., 2002. Proton-gated channels in PC12

    cells. J. Neurophysiol. 87, 2555–2561

    .

    Dauer, W., Przedborski, S., 2003. Parkinson's disease: mechanisms

    and fashions. Neuron 39, 889–909

    .

    Dong, X.P., Xu, T.L., 2002. Radix paeoniae rubra suppression of

    sodium present in acutely dissociated rat hippocampal CA1

    neurons. mind Res. 940, 1 – 9

    .

    Huang, J.Z., Chen, Y.Z., Su, M., Zheng, H.F., Yang, Y.P., Chen, J., Liu,

    C.F., 2010. DL-three-n-butylphthalide prevents oxidative harm

    and reduces mitochondrial dysfunction in an MPP

    +

    -prompted

    mobile mannequin of Parkinson's disease. Neurosci. Lett. 475,

    89–94

    .

    Huang, okay.S., Lin, J.G., Lee, H.C., Tsai, F.J., Bau, D.T., Huang, C.Y.,

    Yao, C.H., Chen, Y.S., 2009. Paeoniae albaRadix promotes

    peripheral nerve regeneration. Evid. primarily based Complement

    Alternat. Med.

    Jasti, J., Furukawa, H., Gonzales, E.B., Gouaux, E., 2007. constitution of

    acid-sensing ion channel 1 at 1.9 A resolution and low pH.

    Nature 449, 316–323

    .

    Joch, M., Ase, A.R., Chen, C.X., MacDonald, P.A., Kontogiannea, M.,

    Corera, A.T., Brice, A., Seguela, P., Fon, E.A., 2007.

    Parkin-mediated monoubiquitination of the PDZ protein PICK1

    regulates the endeavor of acid-sensing ion channels. Mol. Biol.

    mobilephone 18, 3105–3118

    .

    Kellenberger, S., Gautschi, I., Schild, L., 2002. An exterior website

    controls closing of the epithelial Na+ channel ENaC. J. Physiol.

    543, 413–424

    .

    Kim, Y.J., Ko, H.H., Han, E.S., Lee, C.S., 2007. Lamotrigine inhibition

    of rotenone- or 1-methyl-4-phenylpyridinium-brought on

    mitochondrial harm and cell loss of life. brain Res. Bull. 71,

    633–640

    .

    Krishtal, O., 2003. The ASICs: signaling molecules? Modulators?

    trends Neurosci. 26, 477–483

    .

    Levine, B., Kroemer, G., 2008. Autophagy within the pathogenesis of

    sickness. cell 132, 27–forty two

    .

    Pidoplichko, V.I., Dani, J.A., 2006. Acid-sensitive ionic channels in

    midbrain dopamine neurons are delicate to ammonium,

    which may additionally make contributions to hyperammonemia harm. Proc.

    Natl. Acad. Sci. u . s . 103, 11376–11380

    .

    Pignataro, G., Simon, R.P., Xiong, Z.G., 2007. prolonged activation of

    ASIC1a and the time window for neuroprotection in cerebral

    ischaemia. brain 130, 151–158

    .

    Qian, J.J., Cheng, Y.B., Yang, Y.P., Mao, C.J., Qin, Z.H., Li, k., Liu, C.F.,

    2008. Differential results of overexpression of untamed-class and

    mutant human alpha-synuclein on MPP

    +

    -caused

    neurotoxicity in PC12 cells. Neurosci. Lett. 435, 142–146

    .

    table 1 –Primers utilized in PCR and size of products.

    sense primer Antisense primer size (bp)

    ASIC1a GCCCACATCTTCTCCTAT CTTGGTGACGTGGTGATA 212

    ASIC1b CGAAGCAGGCATCAAAGT CGAAGAAATCCGAGTCCAT 179

    ASIC2a GCAACCTGACACGCTACAA GGCAGCAACTTCATACGC 191

    ASIC2b ACCTGACACGCTACAACAA GCAACTTCATACGCCTTC 184

    ASIC3 ATACAACCGCAGCGAGTC TCTTCCTGGAGCAGAGTGTT 246

    ASIC4 TCGCTACCCAGAGCCTGACA CTCTGAGGATCTGCATTGAAGGTG 168

    β-actin TCAGGTCACTATCGGCAAT AAAGAAAGGGTGTAAAACGCA 432

    86 mind analysis 1396 (2011) 77– 87




  • References:


    Pass4sure Certification Exam Questions and Answers - www.founco.com
    Killexams Exam Study Notes | study guides - www.founco.com
    Pass4sure Certification Exam Questions and Answers - st.edu.ge
    Killexams Exam Study Notes | study guides - st.edu.ge
    Pass4sure Certification Exam Questions and Answers - www.jabbat.com
    Killexams Exam Study Notes | study guides - www.jabbat.com
    Pass4sure Certification Exam Questions and Answers - www.jorgefrazao.esy.es
    Killexams Exam Study Notes | study guides - www.jorgefrazao.esy.es
    Pass4sure Certification Exam Questions and Answers and Study Notes - www.makkesoft.com
    Killexams Exam Study Notes | study guides | QA - www.makkesoft.com
    Pass4sure Exam Study Notes - maipu.gob.ar
    Pass4sure Certification Exam Study Notes - idprod.esy.es
    Download Hottest Pass4sure Certification Exams - cscpk.org
    Killexams Study Guides and Exam Simulator - www.simepe.com.br
    Comprehensive Questions and Answers for Certification Exams - www.ynb.no
    Exam Questions and Answers | Brain Dumps - www.4seasonrentacar.com
    Certification Training Questions and Answers - www.interactiveforum.com.mx
    Pass4sure Training Questions and Answers - www.menchinidesign.com
    Real exam Questions and Answers with Exam Simulators - www.pastoriaborgofuro.it
    Real Questions and accurate answers for exam - playmagem.com.br
    Certification Questions and Answers | Exam Simulator | Study Guides - www.rafflesdesignltd.com
    Kill exams certification Training Exams - www.sitespin.co.za
    Latest Certification Exams with Exam Simulator - www.philreeve.com
    Latest and Updated Certification Exams with Exam Simulator - www.tmicon.com.au
    Pass you exam at first attempt with Pass4sure Questions and Answers - tractaricurteadearges.ro
    Latest Certification Exams with Exam Simulator - addscrave.net
    Pass you exam at first attempt with Pass4sure Questions and Answers - alessaconsulting.com
    Get Great Success with Pass4sure Exam Questions/Answers - alchemiawellness.com
    Best Exam Simulator and brain dumps for the exam - andracarmina.com
    Real exam Questions and Answers with Exam Simulators - empoweredbeliefs.com
    Real Questions and accurate answers for exam - www.alexanndre.com
    Certification Questions and Answers | Exam Simulator | Study Guides - allsoulsholidayclub.co.uk